Prev. |  KEGG KO K16817 > 

RIKEN DNA Bank Human Resource - PLA2G16

Gene ID NCBI Gene 11145 |  KEGG hsa:11145
Gene Symbol PLA2G16
Protein Name phospholipase A2 group XVI
Synonyms AdPLA|H-REV107|H-REV107-1|HRASLS3|HREV107|HREV107-1|HREV107-3|HRSL3
Ortholog resources KEGG ortholog (KEGG orthology K16817) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081857 IRAL004K17 pOTB7 BC001387 NM_007069 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041654 ARe04C06 pKA1U5 NM_007069.2  
GGTAGACTAGCCTGCCGAGCCGCCCGCTGGCACCTGCAGCCTCCTGGGCGCCCGCCGGGC
HKR047379 ARe18H11 pKA1U5 NM_007069.2  
GAGAGATCTAATTGGGTAGGGCGGGTGTAGACTAGCCTGCCGAGCCGCCCGCTGGCACCT
HKR179707 ARi49E11 pGCAP10 NM_007069.2  
CGGCCGGCCGATTGGAGACTAGCCTGCCGAGCCGCCCGCTGGCACCTGCAGCCTCCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl