Prev. |  KEGG KO K09554 > 

RIKEN DNA Bank Human Resource - CDC37

Gene ID NCBI Gene 11140 |  KEGG hsa:11140
Gene Symbol CDC37
Protein Name cell division cycle 37
Synonyms P50CDC37
Ortholog resources KEGG ortholog (KEGG orthology K09554) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083015 IRAL007I23 pOTB7 BC000083 NM_007065 Full
HGY085035 IRAL012J19 pOTB7 BC008793 NM_007065 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR061778 ARe54H10 pKA1U5 NM_007065.3  
GGCCACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCAAGATGGTGGACTACAGCGTGTGG
HKR064174 ARe60H06 pKA1U5 NM_007065.3  
GACTCCACTGCTGCCGCCGTCGCCGCCACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCA
HKR071680 ARe79D08 pKA1U5 NM_007065.3  
GCTCCACTGCTGCCGCCGTCGCCGCCACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCAA
HKR168073 ARi20D01 pGCAP10 NM_007065.3  
GACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCAAGATGGTGGACTACAGCGTGTGGGAC
HKR180125 ARi50F05 pGCAP10 NM_007065.3  
CGGCCGGCCGATGACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCAAGATGGTGGACTAC
HKR205379 ARiS013H11 pGCAP10 NM_007065.3  
GGGAGCGGGCTGGGCCGCCAAGGCAAGATGGTGGACTACAGCGTGTGGGACCACATTGAG
HKR360460 RBd01C12 pGCAP10 NM_007065.3  
ACTGCTGCCGCCGTCGCCGCCACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGCAAGATGG
HKR363330 RBd08F10 pGCAP10 NM_007065.3  
GGTCTCCACTGCTGCCGCCGTCGCCGCCACCCGAGCCGGAGCGGGCTGGGCCGCCAAGGC
HKR382003 RBd55A03 pGCAP10 NM_007065.3  
CGGCCGGCCGATGGGCGGGGCTCCGCGCTCCTAGTCTCCACNNNTNNCGCCGTCGCCGCC
HKR391231 RBd78B07 pGCAP10 NM_007065.3  
GAAGGCAAGATGGTGGACTACAGCGTGTGGGACCACATTGAGGTGTCTGATGATGAAGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl