Prev. |  KEGG KO K14791 > 

RIKEN DNA Bank Human Resource - PWP1

Gene ID NCBI Gene 11137 |  KEGG hsa:11137
Gene Symbol PWP1
Protein Name PWP1 homolog, endonuclein
Synonyms IEF-SSP-9502
Ortholog resources KEGG ortholog (KEGG orthology K14791) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX042839 IRAK107B15 pCMV-SPORT6 BC046144 NM_007062 Partial
HGY080948 IRAL002G04 pOTB7 BC001652 NM_007062 Full/var
HGY082927 IRAL007F07 pOTB7 BC000067 NM_007062 Partial/var
HGY095894 IRAL039M06 pOTB7 BC032127 NM_007062 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002379 W01A005P19 pENTR-TOPO IRAL002G04 BC001652 NM_007062  
HGE002381 W01A005P21 pENTR-TOPO IRAL002G04 BC001652 NM_007062  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR264489 ARiS161D17 pGCAP10 NM_007062.1  
GGTGCAGATCCCTGAGCGTGTGGCAGCAGTGCGGTCGTGGTCCCTCCCTATGCAGCCTGG
HKR321257 RBb03C09 pKA1U5 NM_007062.1  
AGGACCATGAACCGCAGCCGCCAGGTGACGTGCGTGGCCTGGGTCCGCTGCGGCGTGGCC
HKR408992 RBdS022H24 pGCAP10 NM_007062.1  
GCTGGCAGCGGCCCTGTGCAGATCCCTGAGCGTGTGGCAGCAGTGCGGTCGTGGTCCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl