Prev. | 

RIKEN DNA Bank Human Resource - CDC42EP1

Gene ID NCBI Gene 11135 |  KEGG hsa:11135
Gene Symbol CDC42EP1
Protein Name CDC42 effector protein 1
Synonyms BORG5|CEP1|MSE55
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090738 IRAL026O02 pOTB7 BC009356 NM_152243 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099212 M01C048A12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099260 M01C048C12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099308 M01C048E12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099356 M01C048G12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099404 M01C048I12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099452 M01C048K12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099500 M01C048M12 pDONR221 MGC13-F06 BC009356 NM_007061  
HGE099548 M01C048O12 pDONR221 MGC13-F06 BC009356 NM_007061  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041211 ARe03A11 pKA1U5 NM_152243.2  
GGCAGACCGGCCCAGCGACTCTCCCGGGCTGCCAGCCGGGACGCGCGGCCGCCGCCGCTG
HKR209584 ARiS023P24 pGCAP10 NM_152243.2  
GGACCGGCCCAGCGACTCTCCCGGGCTGCCAGCCGGGACGCGCGGCCGCCGCCGCTGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl