Prev. |  KEGG KO K19943 > 

RIKEN DNA Bank Human Resource - ZWINT

Gene ID NCBI Gene 11130 |  KEGG hsa:11130
Gene Symbol ZWINT
Protein Name ZW10 interacting kinetochore protein
Synonyms HZwint-1|KNTC2AP|SIP30|ZWINT1
Ortholog resource in our bank

  ZWINT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008245 IRAK020K05 pCMV-SPORT6 BC020979 NM_001005414 Partial
HGY080664 IRAL001K24 pOTB7 BC000411 NM_001005414
HGY092986 IRAL032H18 pDNR-LIB BC016357 NM_001005414

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE026807 W01A067A07 pENTR-TOPO flj0021a17 AK093808 NM_001005414  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR374928 RBd37F08 pGCAP10 NM_001005413.1  
GGAACTCGGCGCCTGGAAAGATGGAGGCAGCGGAGACAGAGGCGGAAGCTGCAGCCCTAG
HKR393282 RBd83D10 pGCAP10 NM_001005413.1  
GAGGCAGCTGAACTCGGCGCCTGGAAAGATGGAGGCAGCGGAGACAGAGGCGGAAGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl