Prev. |  KEGG KO K07767 > 

RIKEN DNA Bank Human Resource - KATNA1

Gene ID NCBI Gene 11104 |  KEGG hsa:11104
Gene Symbol KATNA1
Protein Name katanin catalytic subunit A1
Synonyms -
Ortholog resource in our bank

  KATNA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039367 IRAK098G23 pCMV-SPORT6 BC050428 NM_007044 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068178 ARe70H10 pKA1U5 NM_007044.2  
GAGTTCGCCGAGGTCGTCCCCGGCACCGGAAGTGACCCTGGCGGGTTTGTCTTCAAATTC
HKR373212 RBd33A12 pGCAP10 NM_007044.2  
GGGAAGTGACCCTGGCGGGTTTGTCTTCAAATTCTCGGCGAGCAGGAGCCGCGCCGGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl