Prev. |  KEGG KO K00685 > 

RIKEN DNA Bank Human Resource - ATE1

Gene ID NCBI Gene 11101 |  KEGG hsa:11101
Gene Symbol ATE1
Protein Name arginyltransferase 1
Synonyms -
Ortholog resource in our bank

  ATE1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013446 IRAK033K06 pBluescriptR BC022026 NM_007041 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037916 W01A094N04 pENTR-TOPO IRAK033K06 BC022026 NM_007041  
HGE037920 W01A094N08 pENTR-TOPO IRAK033K06 BC022026 NM_007041  
HGE037924 W01A094N12 pENTR-TOPO IRAK033K06 BC022026 NM_007041  
HGE037962 W01A094P02 pENTR-TOPO IRAK033K06 BC022026 NM_007041  
HGE037968 W01A094P08 pENTR-TOPO IRAK033K06 BC022026 NM_007041  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR339306 RBb48E10 pGCAP1 NM_001001976.1  
TGGCGCCAAGAAGGCGTTGGTCGGCCCGAGCGGACCCTCGCGGCGGCCATGGCGTCGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl