Prev. |  KEGG KO K15047 > 

RIKEN DNA Bank Human Resource - HNRNPUL1

Gene ID NCBI Gene 11100 |  KEGG hsa:11100
Gene Symbol HNRNPUL1
Protein Name heterogeneous nuclear ribonucleoprotein U like 1
Synonyms E1B-AP5|E1BAP5|HNRPUL1
Ortholog resources KEGG ortholog (KEGG orthology K15047) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081929 IRAL004N17 pOTB7 BC002564 NM_144733 Full/var
HGY090500 IRAL026E04 pOTB7 BC027713 NM_144733 Full
HGY090576 IRAL026H08 pOTB7 BC009988 NM_144733 Full/var
HGY092172 IRAL030H04 pOTB7 BC014232 NM_144733 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023104 W01A057M16 pENTR-TOPO flj0033d13 AK022863 NM_144733  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR173375 ARi33H07 pGCAP10 NM_007040.3  
GCTGGAGCCGAAGAGAGTCGGAAGAACAAGAGATGCCATGGACAATATTACCAGGCAGAA
HKR182521 ARi56F01 pGCAP10 NM_007040.3  
GGCCTCCTGACAGGAAAGGTTTAAGGGGGACAGAGCCCTGGGAGGCCGGGCCGGGCTCGG
HKR222163 ARiS055G19 pGCAP10 NM_007040.3  
GGCCCCCCCCCTTTCCCCCTTCGCCTCCTGACAGGAAAGGTTTAAGGGGGACAGAGCCCT
HKR332484 RBb31D12 pGCAP1 NM_007040.3  
GGTGGGCGAGGGGCGGGGTGTCTGGACTGGAACCTCTGGGCCCACATGCCATGGACAATA
HKR334034 RBb35B10 pGCAP1 NM_007040.3  
TTGAAATCATTGTTGGGAAGCTGGGAGGAGAGAGAGAGAGAGGAAGTCGGACGTGGGCGA
HKR361350 RBd03G06 pGCAP10 NM_007040.3  
GCTCCTGACAGGAAAGGTTTAAGGGGGACAGAGCCCTGGGAGGCCGGGCCGGGCTCGGGG
HKR364031 RBd10B07 pGCAP10 NM_007040.3  
GACTGGGGGAGGGGCCTCTGGGTTTCGGAGGTGAGGGACGGGGGTGGCGGGGAGGATTCC
HKR433274 RBdS083D02 pGCAP10 NM_007040.3  
GAGAGGAAGTCGGACGTGGGCGAGGGGCGGGGTGTCTGGACTGGAACCTCTGGGCCCACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl