Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUPL2

Gene ID (NCBI) 11097
Gene Symbol NUPL2
Protein Name nucleoporin like 2
Synonyms CG1|NLP-1|NLP_1|hCG1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY086401 IRAL016A01 pDNR-LIB BC005327 NM_007342 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR330030 RBb25B06 pGCAP1 NM_007342.2
GGCAGACTGAAGACGCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTC
HKR347301 RBb68E05 pGCAP1 NM_007342.2
GGCAGACTGAAGACGCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTC
HKR386808 RBd67A08 pGCAP10 NM_007342.2
GNCGGCNNGNACTGACGACGCCCTCCGNCNGCNACNCCNNCANANNGNNCNTTTGTCNNT
HKR441734 RBdS104F14 pGCAP10 NM_007342.2
GAGACNCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTCCTTCAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl