Prev. |  KEGG KO K14321 > 

RIKEN DNA Bank Human Resource - NUP42

Gene ID NCBI Gene 11097 |  KEGG hsa:11097
Gene Symbol NUP42
Protein Name nucleoporin 42
Synonyms CG1|NLP-1|NLP_1|NUPL2|hCG1
Ortholog resource in our bank

  NUP42

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086401 IRAL016A01 pDNR-LIB BC005327 NM_007342 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330030 RBb25B06 pGCAP1 NM_007342.2  
GGCAGACTGAAGACGCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTC
HKR347301 RBb68E05 pGCAP1 NM_007342.2  
GGCAGACTGAAGACGCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTC
HKR386808 RBd67A08 pGCAP10 NM_007342.2  
GNCGGCNNGNACTGACGACGCCCTCCGNCNGCNACNCCNNCANANNGNNCNTTTGTCNNT
HKR441734 RBdS104F14 pGCAP10 NM_007342.2  
GAGACNCCCTCCGTCAGCGACGCCGTCGCAATGGCCATTTGTCAATTCTTCCTTCAAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl