Prev. | 

RIKEN DNA Bank Human Resource - CACFD1

Gene ID NCBI Gene 11094 |  KEGG hsa:11094
Gene Symbol CACFD1
Protein Name calcium channel flower domain containing 1
Synonyms C9orf7|D9S2135|FLOWER
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025942 IRAK064O06 pCMV-SPORT6 BC030558 NM_017586 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219892 ARiS049M04 pGCAP10 NM_017586.2  
TGGCGGGCGCCGGCTCGGACGCGGCCGGCTACCGAGCCCTTTGTGAGAGCTGTGAGCTGC
HKR375330 RBd38F10 pGCAP10 NM_017586.2  
GGCGGCCGGCTACCGAGCCCTTTGTGAGAGCTGTGAGCTGCGCCTGACGGTGGCACCATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl