Prev. | 

RIKEN DNA Bank Human Resource - DIDO1

Gene ID NCBI Gene 11083 |  KEGG hsa:11083
Gene Symbol DIDO1
Protein Name death inducer-obliterator 1
Synonyms BYE1|C20orf158|DATF-1|DATF1|DIDO2|DIDO3|DIO-1|DIO1|dJ885L7.8
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081152 IRAL002O16 pOTB7 BC004237 NM_080796 Full
HGY082994 IRAL007I02 pOTB7 BC000770 NM_080797 Partial/var
HGY093913 IRAL034N01 pOTB7 BC014489 NM_080796 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025432 W01A063J16 pENTR-TOPO IRAL002O16 BC004237 NM_080796  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043697 ARe09E01 pKA1U5 NM_080796.2  
GAGCCCCGCGCCATCTCGGTGGCCGTCCGCCCACTCCGCGGCGTTCGGGGAAATGGCTGC
HKR046403 ARe16A03 pKA1U5 NM_080796.2  
GGGGGAAATGGCTGCGAGACCCTAGAGGCCTGCGGCCTGCGGAGCTTACTCCACGGGAAC
HKR371232 RBd28B08 pGCAP10 NM_080796.2  
GAGGCGTCGGCCCTCTGGCAAGATGGCTGCTGCGGAGGCGTTGGAGCGCGGAAATCTGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl