Prev. |  KEGG KO K14165 > 

RIKEN DNA Bank Human Resource - DUSP14

Gene ID NCBI Gene 11072 |  KEGG hsa:11072
Gene Symbol DUSP14
Protein Name dual specificity phosphatase 14
Synonyms MKP-L|MKP6
Ortholog resource in our bank

  DUSP14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080416 IRAL001A16 pOTB7 BC000370 NM_007026 Full
HGY083455 IRAL008K15 pOTB7 BC001894 NM_007026 Full
HGY083841 IRAL009K01 pOTB7 BC004448 NM_007026 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR058853 ARe47C05 pKA1U5 NM_007026.2  
AGAAGCCGGTGGCCGCGCAGGAGGACGGAGCCCTAACCGCAACCCGCGCCGCGCCGCGCC
HKR174952 ARi37G08 pGCAP10 NM_007026.2  
GGGCGCGCGCGGCGCCCAGCCCGCAGAAGCCGGTGGCCGCGCAGGAGGACGGAGCCCTAA
HKR249184 ARiS122P24 pGCAP10 NM_007026.2  
GGCAGAAGCCGGTGGCCGCGCAGGAGGACGGAGCCCTAACCGCAACCCGCGCCGCGCCGC
HKR348435 RBb71B11 pGCAP1 NM_007026.2  
AGGGCAGAAGCCGGTGGCCGCGCAGGAGGACGGAGCCCTAACCGCAACCCGCGCCGCGCC
HKR380402 RBd51A02 pGCAP10 NM_007026.2  
GGCAGAAGCCGGTGGCCGCGCAGGAGGACGGAGCCCTAACCGCAACCCGCGCCGCGCCGC
HKR433545 RBdS083O09 pGCAP10 NM_007026.2  
GGGGCGCGGGCGGAGGGAGGAGGAGGCGGCGCGCGCGGCGCCCAGCCCGCAGAAGCCGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl