RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - DUS4L

Gene ID	NCBI Gene 11062 \| KEGG hsa:11062
Gene Symbol	DUS4L
Protein Name	dihydrouridine synthase 4 like
Synonyms	DUS4\|PP35

Ortholog resource in our bank

  DUS4L

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR008932	ARa22F12	pKA1U5	NM_181581.1
HKR008932	GCGCCCACCCAGCCCATGGCTCCAGGCCCACCTGGCGAACTGACTCTCAGCCCGCGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl