Prev. |  KEGG KO K05633 > 

RIKEN DNA Bank Human Resource - WWP1

Gene ID NCBI Gene 11059 |  KEGG hsa:11059
Gene Symbol WWP1
Protein Name WW domain containing E3 ubiquitin protein ligase 1
Synonyms AIP5|Tiul1|hSDRP1
Featured content Endocytosis (human)
Ortholog resource in our bank

  WWP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008942 IRAK022F22 pCMV-SPORT6 BC015380 NM_007013 Partial
HGY019460 IRAK048K20 pBluescriptR BC036065 NM_007013 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099626 M01C049B02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099674 M01C049D02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099722 M01C049F02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099770 M01C049H02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099818 M01C049J02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099866 M01C049L02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099914 M01C049N02 pDONR221 MGC14-D01 BC036065 NM_007013  
HGE099962 M01C049P02 pDONR221 MGC14-D01 BC036065 NM_007013  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044827 ARe12B03 pKA1U5 NM_007013.3  
GGGGTGTCGGCGAGCTCCGCGTGCGGGTTCCGAGTGGCTGCTGGCGGCCTGGGCTGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl