Prev. |  KEGG KO K14398 > 

RIKEN DNA Bank Human Resource - CPSF6

Gene ID NCBI Gene 11052 |  KEGG hsa:11052
Gene Symbol CPSF6
Protein Name cleavage and polyadenylation specific factor 6
Synonyms CFIM|CFIM68|CFIM72|HPBRII-4|HPBRII-7
Ortholog resource in our bank

  CPSF6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082850 IRAL007C02 pOTB7 BC000714 NM_007007 Full/var
HGY083880 IRAL009L16 pOTB7 BC005000 NM_007007 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE025709 W01A064E13 pENTR-TOPO IRAL007C02 BC000714 NM_007007  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052475 ARe31D03 pKA1U5 NM_007007.2  
GGCCGCTAGATCCGCTGCTGCTGCCGCGGCGGGCAGACCTGCAGGAGGCGGCGGCGGCGG
HKR321302 RBb03E06 pKA1U5 NM_007007.2  
GACCTGCAGGAGGCGGCGGCGGCGGCGGCGGCCGAGGCTGAAGGAAGATGGCGGACGGCG
HKR327609 RBb19A09 pKA1U5 NM_007007.2  
ATCCTGTGGCGGGCTGCTGCCGCGGCGGGCGGACCTGCAGGAGGCGGCGGCGGCGGCGGC
HKR471039 RBdS177J23 pGCAP10 NM_007007.2  
GGCTANATCCGCTGCTGCTGCCGCGGCGGGCGGACCTGCAGGAGGCGGCGGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl