Prev. |  KEGG KO K15281 > 

RIKEN DNA Bank Human Resource - SLC35D2

Gene ID NCBI Gene 11046 |  KEGG hsa:11046
Gene Symbol SLC35D2
Protein Name solute carrier family 35 member D2
Synonyms HFRC1|SQV7L|UGTrel8|hfrc
Ortholog resource in our bank

  SLC35D2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087366 IRAL018G22 pOTB7 BC009413 NM_007001 Partial/var
HGY092770 IRAL031P10 pDNR-LIB BC015146 NM_007001 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171257 ARi28C09 pGCAP10 NM_007001.1  
GGGGGCTGGCGGGCGGCGGGGTCCGCGGGGCCGCAGGAGATGACGGCCGGCGGCCAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl