Prev. |  KEGG KO K21032 > 

RIKEN DNA Bank Human Resource - B4GAT1

Gene ID NCBI Gene 11041 |  KEGG hsa:11041
Gene Symbol B4GAT1
Protein Name beta-1,4-glucuronyltransferase 1
Synonyms B3GN-T1|B3GNT1|B3GNT6|BETA3GNTI|MDDGA13|iGAT|iGNT
Ortholog resources KEGG ortholog (KEGG orthology K21032) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081377 IRAL003H09 pOTB7 BC021965 NM_006876 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046858 ARe17C10 pKA1U5 NM_006876.2  
AAAATCCGGGCTTGCGGCCGCTGGCGTAGTCTGTGGCCGGGTGGTCGTTGCTGCGCGCCC
HKR055325 ARe38F05 pKA1U5 NM_006876.2  
ATCCTGGGCAGGCTGCGGTAAATCCGGGCTTGCGGCCGCTGGCGTAGTCTGTGGCCGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl