Prev. | 

RIKEN DNA Bank Human Resource - RBPMS

Gene ID NCBI Gene 11030 |  KEGG hsa:11030
Gene Symbol RBPMS
Protein Name RNA binding protein, mRNA processing factor
Synonyms HERMES
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX054316 IRAK135N04 pCMV-SPORT6 BC063494 NM_001008712 Partial
HGY083163 IRAL007P03 pOTB7 BC003608 NM_001008712 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097228 M01C043B04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097276 M01C043D04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097324 M01C043F04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097372 M01C043H04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097420 M01C043J04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097468 M01C043L04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097516 M01C043N04 pDONR221 MGC11-D02 BC003608 NM_001008712  
HGE097564 M01C043P04 pDONR221 MGC11-D02 BC003608 NM_001008712  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064099 ARe60E03 pKA1U5 NM_006867.2  
GGCGCCCCGCTCCCTCCGGGCTGCAGCCGGCAGCCCACNTTCCAGGGAGGGCGGAGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl