Prev. |  KEGG KO K18406 > 

RIKEN DNA Bank Human Resource - TDRKH

Gene ID NCBI Gene 11022 |  KEGG hsa:11022
Gene Symbol TDRKH
Protein Name tudor and KH domain containing
Synonyms TDRD2
Ortholog resource in our bank

  TDRKH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027632 IRAK069B08 pCMV-SPORT6 BC032690 NM_006862 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE094012 M01C035A12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094060 M01C035C12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094108 M01C035E12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094156 M01C035G12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094204 M01C035I12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094252 M01C035K12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094300 M01C035M12 pDONR221 MGC07-B06 BC032690 ENST00000368827  
HGE094348 M01C035O12 pDONR221 MGC07-B06 BC032690 ENST00000368827  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR050176 ARe25H08 pKA1U5 NM_006862.3  
GGGGCTCACTGTGGTGGTGTGAGTGGGAGGCGGCGGCGCTGGTGGCTGCAGCTGGGGTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl