Prev. |  KEGG KO K12846 > 

RIKEN DNA Bank Human Resource - SNRNP27

Gene ID NCBI Gene 11017 |  KEGG hsa:11017
Gene Symbol SNRNP27
Protein Name small nuclear ribonucleoprotein U4/U6.U5 subunit 27
Synonyms 27K|RY1
Ortholog resource in our bank

  SNRNP27

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094781 IRAL036P21 pDNR-LIB BC017890 NM_006857

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000562 W01A001G18 pENTR-TOPO IRAL036P21 BC017890 NM_006857  
HGE000568 W01A001G24 pENTR-TOPO IRAL036P21 BC017890 NM_006857  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR337653 RBb44C05 pGCAP1 NM_006857.1  
GTTTTTTCCGGGAAGCGGGACTCCAAATGGGTCGCAGTCGCAGCCGCTCTCCACGGAGGG
HKR342873 RBb57D01 pGCAP1 NM_006857.1  
TGGGGACTCCAAATGGGTCGCAGTCGCAGCCGCTCTCCACGGAGGGAACGTAGGCGTTCC
HKR382947 RBd57G03 pGCAP10 NM_006857.1  
GGTTTTCCGGGAAGCGGGACTCCAAATGGGTCGCAGTCGCAGCCGCTCTCCACGGAGGGA
HKR388001 RBd70A01 pGCAP10 NM_006857.1  
GGTTTTCCGGGAAGCGGGACTCCAAATGGGTCGCAGTCGCAGCCGCTCTCCACGGAGGGA
HKR406087 RBdS015D15 pGCAP10 NM_006857.1  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl