Prev. |  KEGG KO K08864 > 

RIKEN DNA Bank Human Resource - TLK2

Gene ID NCBI Gene 11011 |  KEGG hsa:11011
Gene Symbol TLK2
Protein Name tousled like kinase 2
Synonyms HsHPK|MRD57|PKU-ALPHA
Ortholog resource in our bank

  TLK2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030784 IRAK076P24 pBluescriptR BC044925 NM_006852 Full/var
HGX008686 IRAK021L22 pCMV-SPORT6 BC013736 NM_006852
HGY099357 IRAL048G13 pDNR-LIB BC060511 NM_006852 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE088441 M01C021B17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088489 M01C021D17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088537 M01C021F17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088585 M01C021H17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088633 M01C021J17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088681 M01C021L17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088729 M01C021N17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE088777 M01C021P17 pDONR221 IMS03-C09 BC044925 NM_006852  
HGE090818 M01C027A18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE090866 M01C027C18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE090914 M01C027E18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE090962 M01C027G18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE091010 M01C027I18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE091058 M01C027K18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE091106 M01C027M18 pDONR221 MGC03-B09 BC044925 NM_006852  
HGE091154 M01C027O18 pDONR221 MGC03-B09 BC044925 NM_006852  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR376108 RBd40E12 pGCAP10 NM_006852.3  
GGAACCGATCCGGATTAAGGGGCCGGAGGCGGGTCCTGGGCACCAGCGGTTCCGACCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl