Prev. | 

RIKEN DNA Bank Human Resource - GLIPR1

Gene ID NCBI Gene 11010 |  KEGG hsa:11010
Gene Symbol GLIPR1
Protein Name GLI pathogenesis related 1
Synonyms CRISP7|GLIPR|RTVP1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011246 IRAK028B22 pCMV-SPORT6 BC012510 NM_006851 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042035 ARe05B11 pKA1U5 NM_006851.2  
GAAGGCTCCATGCCAGACAAAGCATGCGTGTCACACTTGCTACAATAGCCTGGATGGTTT
HKR056151 ARe40G07 pKA1U5 NM_006851.2  
GGCAAAGCTGTGGGCTGAGCACTCAGGCAATCACACTCTCAGAAACTGCGGCGGCTCTGG
HKR164123 ARi10F03 pGCAP10 NM_006851.2  
TTTTTCTCAAAGCTGAAGTCGGCTAGGTTTGCAAAGCTGTGGGCTGAGCACTCAGGCAAT
HKR186860 ARi67C12 pGCAP10 NM_006851.2  
GGCAAAGCTGTGGGCTGAGCACTCAGGCAATCACACTCTCAGAAACTGCGGCGGCTCTGG
HKR186902 ARi67E06 pGCAP10 NM_006851.2  
GTCTGTTTTCTCAAAGCTGAAGTCGGCTAGGTTTGCAAAGCTGTGGGCTGAGCACTCAGG
HKR238442 ARiS096B18 pGCAP10 NM_006851.2  
GGTTTTCTCAAAGCTGAAGTCGGCTAGGTTTGCAAAGCTGTGGGCTGAGCACTCAGGCAA
HKR238614 ARiS096I22 pGCAP10 NM_006851.2  
NNGGCAAAGCNGTGGGCTGAGCACTCAGGCAATCACACTCTCAGAAACTGCGGCGGCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl