Prev. |  KEGG KO K16758 > 

RIKEN DNA Bank Human Resource - CCDC85B

Gene ID NCBI Gene 11007 |  KEGG hsa:11007
Gene Symbol CCDC85B
Protein Name coiled-coil domain containing 85B
Synonyms DIPA
Ortholog resources KEGG ortholog (KEGG orthology K16758) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085173 IRAL012P13 pOTB7 BC008796 NM_006848 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE024692 W01A061M04 pENTR-TOPO IRAL012P13 BC008796 NM_006848  
HGE024694 W01A061M06 pENTR-TOPO IRAL012P13 BC008796 NM_006848  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078498 ARe96E02 pKA1U5 NM_006848.2  
GTTTTGAGCCCGGGTAGCTGCTGCAGCCTACGCTGCCTCGGCCACTGCCTGCCGCGTGCG
HKR175772 ARi39H04 pGCAP10 NM_006848.2  
GCACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTGAGTGGCGCCGGGCCCGACGTGG
HKR209473 ARiS023L09 pGCAP10 NM_006848.2  
GCACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTGAGTGGCGCCGGGCCCGACGTGG
HKR209570 ARiS023P10 pGCAP10 NM_006848.2  
GCACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTGAGTGGCGCCGGGCCCGACGTGG
HKR325332 RBb13F12 pKA1U5 NM_006848.2  
GGCCCAGCCCGGGATAGCTGCTGCAGCCTACGCTGCCTCGGCCACTGCCTGCCGCGTGCG
HKR380059 RBd50C11 pGCAP10 NM_006848.2  
GGCTGCCTCGGCCACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTGAGTGGCGCCGG
HKR384476 RBd61D04 pGCAP10 NM_006848.2  
GACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTGAGTGGCGCCGGGCCCGACGTGGG
HKR461981 RBdS154P21 pGCAP10 NM_006848.2  
ATGGCAGCCTACGCTGCCTCGGCCACTGCCTGCCGCGTGCGGAGCCGGAGCCCGAGCCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl