Prev. |  KEGG KO K10393 > 

RIKEN DNA Bank Human Resource - KIF2C

Gene ID NCBI Gene 11004 |  KEGG hsa:11004
Gene Symbol KIF2C
Protein Name kinesin family member 2C
Synonyms CT139|KNSL6|MCAK
Ortholog resource in our bank

  KIF2C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04472 SEREX clone BRC-Co-2 #1 SEREX clone BRC-Co-2 #1
RDB04517 SEREX clone NGO-Co-2 (ID 2236) #1 SEREX clone NGO-Co-2 (ID 2236) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006141 IRAK015F21 pCMV-SPORT6 BC014924 NM_006845 Full/var
HGY082172 IRAL005H04 pOTB7 BC008764 NM_006845 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE008517 W01A021E21 pENTR-TOPO IRAL005H04 BC008764 NM_006845  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR183236 ARi58B12 pGCAP10 NM_006845.3  
GACTTCGTAGGGTTAGCGAANTTGAGGTTTCTTGGTATTGCGCGTTTCTCTTCCTTGCTG
HKR346571 RBb66H03 pGCAP1 NM_006845.3  
AAACTGCGGCGGTTTACGCGGCGTTAAGACTTCGTAGGGTTAGCGAAATTGAGGTTTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl