Prev. | 

RIKEN DNA Bank Human Resource - GCN1

Gene ID NCBI Gene 10985 |  KEGG hsa:10985
Gene Symbol GCN1
Protein Name GCN1, eIF2 alpha kinase activator homolog
Synonyms GCN1L|GCN1L1|PRIC295
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025748 IRAK064G04 pCMV-SPORT6 BC032335 NM_006836 Partial
HGX033650 IRAK084C02 pCMV-SPORT6 BC040172 NM_006836 Partial
HGX042841 IRAK107B17 pCMV-SPORT6 BC046177 NM_006836 Partial
HGX053812 IRAK134I20 pCMV-SPORT6 BC064346 NM_006836 Partial
HGY096124 IRAL040F04 pOTB7 BC021129 NM_006836 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR177372 ARi43H04 pGCAP10 NM_006836.1  
GAGCCCCGGCAGGATGGCGGCGGACACGCAGGTTTCCGAGACACTAAAGCGTTTTGCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl