Prev. | 

RIKEN DNA Bank Human Resource - CCNI

Gene ID NCBI Gene 10983 |  KEGG hsa:10983
Gene Symbol CCNI
Protein Name cyclin I
Synonyms CCNI1|CYC1|CYI
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080744 IRAL001O08 pOTB7 BC000420 NM_006835 Full
HGY083640 IRAL009B16 pOTB7 BC004975 NM_006835 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040857 ARe02C09 pKA1U5 NM_006835.2  
GCCCCTCCCTCCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTT
HKR050877 ARe27D05 pKA1U5 NM_006835.2  
GGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTCTTATTTTTCCCCCCTTTCCCCT
HKR066170 ARe65H02 pKA1U5 NM_006835.2  
GCCCTCCCTCCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTC
HKR070947 ARe77G03 pKA1U5 NM_006835.2  
GCCTCCCTCCCCAGCCTTCCCCGCGAGCGGACCCCNTAAAGCCTCTGTCTCGCTTTTTCT
HKR080507 ARf01E11 pKA1U5 NM_006835.2  
GCTCCCTCCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTCTT
HKR172549 ARi31G05 pGCAP10 NM_006835.2  
CGGCCGGCCGATGTCTCCCTCCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGT
HKR218313 ARiS045N01 pGCAP10 NM_006835.2  
GCCCCTCCCTCCCCANCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTT
HKR218332 ARiS045N20 pGCAP10 NM_006835.2  
GAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTCTTATTTTTCCCC
HKR222178 ARiS055H10 pGCAP10 NM_006835.2  
GCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTCTTATTTTTC
HKR248936 ARiS122F16 pGCAP10 NM_006835.2  
GTCCCTCCCCAGCCTTCCCCGCGAGCGGACGCGGCAGCGCCTCTGTCTCGCTTTTTCTTA
HKR276658 ARiS191K18 pGCAP10 NM_006835.2  
GCTTCCGCTCCTTCAAGGAAAATGAGTCCACGGACCTTCGGCTTTTCTTAGCCACGAGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl