Prev. |  KEGG KO K07918 > 

RIKEN DNA Bank Human Resource - RAB32

Gene ID NCBI Gene 10981 |  KEGG hsa:10981
Gene Symbol RAB32
Protein Name RAB32, member RAS oncogene family
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07918) in the DNA Bank
Featured content Rab Family - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087859 IRAL019K19 pDNR-LIB BC015061 NM_006834 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041725 ARe04F05 pKA1U5 NM_006834.3  
GGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCGGCCTGGGGG
HKR054877 ARe37D05 pKA1U5 NM_006834.3  
GAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCAG
HKR062431 ARe56B07 pKA1U5 NM_006834.3  
GAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGCCATTATAGGCGCGCCCGACAGCCGCA
HKR066574 ARe66H06 pKA1U5 NM_006834.3  
GAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGG
HKR078855 ARe97C07 pKA1U5 NM_006834.3  
GGAGAGCGCGAGGCCGGGCAGGGGGCCAGACTCGGAGTCGAGGCGCGCCCGACAGCCGCA
HKR078926 ARe97F06 pKA1U5 NM_006834.3  
GGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCGGCCTGGGGGCG
HKR164526 ARi11F06 pGCAP10 NM_006834.3  
GAGGCGGCGTCAGCGGGCGCGGCGGAGGGCTGGCCGGCCTCGGGGGAGTTTCCGCGGCCG
HKR166977 ARi17H09 pGCAP10 NM_006834.3  
GGAGTTTCCGCGGCCGCCGGGGGCGCGGCGGCAGAGCGCGANGCCNGGCAGGGGGCCAGA
HKR203545 ARiS008O09 pGCAP10 NM_006834.3  
GGGAGTCGAGGCGCNCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCC
HKR248935 ARiS122F15 pGCAP10 NM_006834.3  
GAGTCGAGGCGCGCCCGACAGCCGCAGCGCTCATGGCGGGCGGAGGAGCCGGGGACCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl