Prev. |  KEGG KO K12179 > 

RIKEN DNA Bank Human Resource - COPS6

Gene ID NCBI Gene 10980 |  KEGG hsa:10980
Gene Symbol COPS6
Protein Name COP9 signalosome subunit 6
Synonyms CSN6|MOV34-34KD
Ortholog resource in our bank

  COPS6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081708 IRAL004E12 pOTB7 BC002520 NM_006833 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040847 W01A102B23 pENTR-TOPO IRAL004E12 BC002520 NM_006833  
HGE040875 W01A102D03 pENTR-TOPO IRAL004E12 BC002520 NM_006833  
HGE040883 W01A102D11 pENTR-TOPO IRAL004E12 BC002520 NM_006833  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175375 ARi38H07 pGCAP10 NM_006833.4  
TAAACTGGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAGGAA
HKR183352 ARi58G08 pGCAP10 NM_006833.4  
GGCCGAGGCTGGCGGGCGCGGGGANNTGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAN
HKR279246 ARiS198B22 pGCAP10 NM_006833.4  
HKR329779 RBb24H11 pGCAP1 NM_006833.4  
GCGAGGCTGGCGGGCGCGGGGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAAC
HKR370571 RBd26H03 pGCAP10 NM_006833.4  
GGCTGGCGGGCGCGGGGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGA
HKR383655 RBd59C07 pGCAP10 NM_006833.4  
GGGGCGCGGGGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAG
HKR403017 RBdS007J01 pGCAP10 NM_006833.4  
GGGGGAAAATGGCGGCGGCGGCGGCGGCGGCTGCAGCTACGAACGGGACCGGAGGAAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl