Prev. |  KEGG KO K13999 > 

RIKEN DNA Bank Human Resource - CKAP4

Gene ID NCBI Gene 10970 |  KEGG hsa:10970
Gene Symbol CKAP4
Protein Name cytoskeleton associated protein 4
Synonyms CLIMP-63|CLIMP63|ERGIC-63|p63
Ortholog resource in our bank

  CKAP4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011011 IRAK027I19 pCMV-SPORT6 BC015436 NM_006825
HGX031632 IRAK079B08 pCMV-SPORT6 BC037578 NM_006825 Partial/var
HGY097129 IRAL042N17 pOTB7 BC025341 NM_006825
HGY100253 IRAL050K13 pOTB7 BC067357 NM_006825 Full/var
HGY103785 IRAL059H17 pOTB7 BC082972 NM_006825 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE023859 W01A059K19 pENTR-TOPO flj0068a09 AK123693 NM_006825  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168123 ARi20F03 pGCAP10 NM_006825.3  
GAGCAGCCGCCGCCGCCGCCCGCGCCGCACCCGCAGCAGCACCCGCAGCAGCACCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl