Prev. |  KEGG KO K13999 > 

RIKEN DNA Bank Human Resource - CKAP4

Gene ID NCBI Gene 10970 |  KEGG hsa:10970
Gene Symbol CKAP4
Protein Name cytoskeleton associated protein 4
Synonyms CLIMP-63|ERGIC-63|p63
Ortholog resources KEGG ortholog (KEGG orthology K13999) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011011 IRAK027I19 pCMV-SPORT6 BC015436 NM_006825
HGX031632 IRAK079B08 pCMV-SPORT6 BC037578 NM_006825 Partial/var
HGY103785 IRAL059H17 pOTB7 BC082972 NM_006825 Full
HGY097129 IRAL042N17 pOTB7 BC025341 NM_006825
HGY100253 IRAL050K13 pOTB7 BC067357 NM_006825 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023859 W01A059K19 pENTR-TOPO flj0068a09 AK123693 NM_006825  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168123 ARi20F03 pGCAP10 NM_006825.3  
GAGCAGCCGCCGCCGCCGCCCGCGCCGCACCCGCAGCAGCACCCGCAGCAGCACCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl