Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACOT2

Gene ID (NCBI) 10965
Gene Symbol ACOT2
Protein Name acyl-CoA thioesterase 2
Synonyms CTE-IA|CTE1A|MTE1|PTE2|PTE2A|ZAP128
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080949 IRAL002G05 pOTB7 BC006500 NM_006821 Partial/var
HGY083801 IRAL009I09 pOTB7 BC004436 NM_006821 Partial/var
HGY087155 IRAL017O19 pOTB7 BC006335 NM_006821

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR209536 ARiS023N24 pGCAP10 NM_006821.4
GACTCTTGGCGAGCTGGACCTGGAGCGCGCGCCCGCGCTGGGCGGCAGCTTCGCGGGGCT
HKR279566 ARiS198P06 pGCAP10 NM_006821.4
GACTCTTGGCGAGCTGGACCTGGAGCGCGCGCCCGCGCTGGGCGGCAGCTTCGCGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.04

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl