Prev. |  KEGG KO K01068 > 

RIKEN DNA Bank Human Resource - ACOT2

Gene ID NCBI Gene 10965 |  KEGG hsa:10965
Gene Symbol ACOT2
Protein Name acyl-CoA thioesterase 2
Synonyms CTE-IA|CTE1A|MTE1|PTE2|PTE2A|ZAP128
Ortholog resource in our bank

  ACOT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080949 IRAL002G05 pOTB7 BC006500 NM_006821 Partial/var
HGY083801 IRAL009I09 pOTB7 BC004436 NM_006821 Partial/var
HGY087155 IRAL017O19 pOTB7 BC006335 NM_006821

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR209536 ARiS023N24 pGCAP10 NM_006821.4  
GACTCTTGGCGAGCTGGACCTGGAGCGCGCGCCCGCGCTGGGCGGCAGCTTCGCGGGGCT
HKR279566 ARiS198P06 pGCAP10 NM_006821.4  
GACTCTTGGCGAGCTGGACCTGGAGCGCGCGCCCGCGCTGGGCGGCAGCTTCGCGGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl