RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - PNRC1

Gene ID	NCBI Gene 10957 \| KEGG hsa:10957
Gene Symbol	PNRC1
Protein Name	proline rich nuclear receptor coactivator 1
Synonyms	B4-2\|PNAS-145\|PROL2\|PRR2

Ortholog resource in our bank

  PNRC1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX009170	IRAK022P10	pCMV-SPORT6	BC018112	NM_006813	Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number	Clone name	Vector	Constructed from⁽¹⁾		CDS comparison		Status
Catalog number	Clone name	Vector	Clone ID	Sequence (DDBJ)	Refered mRNA	CDS status	Status
HGE011349	W01A028G05	pENTR-TOPO	IRAK022P10	BC018112	NM_006813

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR053250	ARe33C02	pKA1U5	NM_006813.1
HKR053250	GGTTGCTGCGCCGCCACCGCCCGAGTCATGTTCCGCGATCTTCTCAGGCTCTCCTAGCAG
HKR081725	ARf04F05	pKA1U5	NM_006813.1
HKR081725	GGTTGCTGCGCCGCCACCGCCCGAGTCATGTTCCGCGATCTTCTCAGGCTCTCCTAGCAG
HKR184410	ARi61A10	pGCAP10	NM_006813.1
HKR184410	GGTTGCTGCGCCGCCACCGCCCGAGTCATGTTCCGCGATCTTCTCAGGCTCTCCTAGCAG
HKR276434	ARiS191B10	pGCAP10	NM_006813.1
HKR276434	GGTTGCTGCGCCGCCACCGCCCGAGTCATGTTCCGCGATCTTCTCAGGCTCTCCTAGCAG
HKR375660	RBd39C12	pGCAP10	NM_006813.1
HKR375660	GGTTGCTGCGCCGCCACCGCCCGAGTCATGTTCCGCGATCTTCTCAGGCTCTCCTAGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl