Prev. |  KEGG KO K09583 > 

RIKEN DNA Bank Human Resource - PDIA5

Gene ID NCBI Gene 10954 |  KEGG hsa:10954
Gene Symbol PDIA5
Protein Name protein disulfide isomerase family A member 5
Synonyms PDIR
Ortholog resources KEGG ortholog (KEGG orthology K09583) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083337 IRAL008F17 pOTB7 BC001625 NM_006810 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR050953 ARe27G09 pKA1U5 NM_006810.2  
GGTGGTGGTTGGCCGCGGTGGAGCTAGCAGGCGGGCGGGCGGGAGCGGGCGCCGGAGTGG
HKR078003 ARe95A03 pKA1U5 NM_006810.2  
GAGGCGGGCGGGCGGGAGCGGGCGCCGGAGTGGAGAAAGGAGCCAGCGGTGGGCAGCGCT
HKR361725 RBd04F05 pGCAP10 NM_006810.2  
GGGCTGGGAAGTGGCCGTGGTGGTTGGCCGCGGTGGAGCTAGCAGGCGGGCGGGCGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl