DNA Bank Top |  KEGG KO K09481 > 

RIKEN DNA Bank Human Resource - SEC61B

Gene ID NCBI Gene 10952 |  KEGG hsa:10952
Gene Symbol SEC61B
Protein Name SEC61 translocon subunit beta
Synonyms -

Link

Ortholog resource in our bank

  SEC61B


External database

human SEC61B

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19411 pFX-SECFP-Sec61 beta Expression vector of SECFP with ER-targeting sequence (human SEC61B) in mammalian cells. NM_006808.3 full cds

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082624 IRAL006J08 pOTB7 BC001734 NM_006808

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097204 M01C043A04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097252 M01C043C04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097300 M01C043E04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097348 M01C043G04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097396 M01C043I04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097444 M01C043K04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097492 M01C043M04 pDONR221 MGC11-B02 BC001734 NM_006808  
HGE097540 M01C043O04 pDONR221 MGC11-B02 BC001734 NM_006808  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040947 ARe02G03 pKA1U5 NM_006808.2  
GGCCACCCTCATCTCCAATATGCCTGGTCCGACCCCNTTTAGGCACTAACGTGGGATCCT
HKR079230 ARe98B06 pKA1U5 NM_006808.2  
GAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGC
HKR164007 ARi10A07 pGCAP10 NM_006808.2  
GAGTCAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGT
HKR173725 ARi34F05 pGCAP10 NM_006808.2  
GGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGCGCCTTG
HKR222250 ARiS055K10 pGCAP10 NM_006808.2  
GGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGCGCCTTG
HKR234199 ARiS085I07 pGCAP10 NM_006808.2  
GAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGC
HKR321369 RBb03H01 pKA1U5 NM_006808.2  
GCTTTTTTCGGGGGCTCCGTAACTTTCTATCCCTCNTCGATCAGCGCCTTGCCACCCTCA
HKR327257 RBb18C09 pKA1U5 NM_006808.2  
GGTCCGCGTCAGCGCCTTGCCACCCTCATCTCCAATATGCCTGGTCCGACCCCCAGTGGC
HKR373773 RBd34H05 pGCAP10 NM_006808.2  
GGCCTGAGTCAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTC
HKR380556 RBd51G12 pGCAP10 NM_006808.2  
TGATCCGTCCGCGTCAGCGCCTTGCCACCCTCATCTCCAATATGCCTGGTCCGACCCCCA
HKR388883 RBd72D11 pGCAP10 NM_006808.2  
GAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGC
HKR416081 RBdS040D09 pGCAP10 NM_006808.2  
GAGTCAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGT
HKR432455 RBdS081C07 pGCAP10 NM_006808.2  
GAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGC
HKR462634 RBdS156J18 pGCAP10 NM_006808.2  
GAGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGC
HKR474905 RBdS187E09 pGCAP10 NM_006808.2  
GCTATCCGTCCGCGTCAGCGCCTTGCCACCCTCATCTCCAATATGCCTGGTCCGACCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2025.03.28

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl