Prev. |  KEGG KO K11585 > 

RIKEN DNA Bank Human Resource - CBX1

Gene ID NCBI Gene 10951 |  KEGG hsa:10951
Gene Symbol CBX1
Protein Name chromobox 1
Synonyms CBX|HP1-BETA|HP1Hs-beta|HP1Hsbeta|M31|MOD1|p25beta
Ortholog resources KEGG ortholog (KEGG orthology K11585) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081914 IRAL004N02 pOTB7 BC002609 NM_006807 Full
HGY095884 IRAL039L20 pOTB7 BC021302 NM_006807

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040547 ARe01G03 pKA1U5 NM_006807.4  
ATCCTGGACGCCGCTTCAGNTGAGGGACGCCACTGTCGGTCACCCGGCTTGCTGCCTTCC
HKR066528 ARe66F08 pKA1U5 NM_006807.4  
GACGCCGCTTCAGTGAGGGACGCCACTGCGGCCACCCGGCTTGCTGCCTTCCTGGGCGCC
HKR080455 ARf01C07 pKA1U5 NM_006807.4  
GGCCGGGGCCTGCGGTACGCCGCTTCAGTGAGGGACGCCACTGCGGCCACCCGGCTTGCT
HKR082098 ARf05E02 pKA1U5 NM_006807.4  
GGCGAGCGGCGGGCAGCGCAGACTGCGAGGCTCTTTTGTTCGGCTGAGGGGAGGGCCGTT
HKR174904 ARi37E08 pGCAP10 NM_006807.4  
GGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCGGTACGCCGCTTCAGTGAGGGAC
HKR335372 RBb38H04 pGCAP1 NM_006807.4  
GAGGCGACCCGACGCGACGCGCCAGTAGCGCAGCACCGAATTCCTCTCGGGCTCTTGGGC
HKR335679 RBb39D07 pGCAP1 NM_006807.4  
GGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCGGTACGCCGCTTCAGTGAGGGAC
HKR363747 RBd09G03 pGCAP10 NM_006807.4  
GGCGCGGTGCGAGCGGCGGGCAGCGCAGACTGCGAGGCTCTTTTGTTCGGCTGAGGGGAG
HKR369774 RBd24H06 pGCAP10 NM_006807.4  
TGGGCAGACTGCGAGGCTCTTTTGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCG
HKR370428 RBd26B04 pGCAP10 NM_006807.4  
GGCAGACTGCGAGGCTCTTTTGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCGGT
HKR390051 RBd75C03 pGCAP10 NM_006807.4  
GGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCGGTACGCCGCTTCAGTGAGGGAC
HKR392975 RBd82H07 pGCAP10 NM_006807.4  
GAGACTGCGAGGCTCTTTTGTTCGGCTGAGGGGAGGGCCGTTGGCCGGGGCCTGCGGTAC
HKR420578 RBdS051H10 pGCAP10 NM_006807.4  
GGGTACGCCGCTTCAGTGAGGGACGCCACTGCGGCCACCCGGCTTGCTGCCTTCCTGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl