Prev. |  KEGG KO K12894 > 

RIKEN DNA Bank Human Resource - HNRNPA0

Gene ID NCBI Gene 10949 |  KEGG hsa:10949
Gene Symbol HNRNPA0
Protein Name heterogeneous nuclear ribonucleoprotein A0
Synonyms HNRPA0
Ortholog resource in our bank

  HNRNPA0

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX007771 IRAK019H03 pCMV-SPORT6 BC011972 NM_006805 Full
HGX017029 IRAK042J13 pCMV-SPORT6 BC028976 NM_006805 Full
HGX025109 IRAK062M21 pCMV-SPORT6 BC030249 NM_006805 Full
HGY080773 IRAL001P13 pOTB7 BC001008 NM_006805 Full
HGY083858 IRAL009K18 pOTB7 BC019271 NM_006805 Full
HGY088279 IRAL020L15 pOTB7 BC009284 NM_006805 Full
HGY089005 IRAL022I13 pOTB7 BC007271 NM_006805 Full
HGY089753 IRAL024G09 pOTB7 BC012980 NM_006805 Full
HGY090655 IRAL026K15 pOTB7 BC018949 NM_006805 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041751 W01A104G07 pENTR-TOPO IRAK019H03 BC011972 NM_006805  
HGE041753 W01A104G09 pENTR-TOPO IRAK019H03 BC011972 NM_006805  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR345259 RBb63C11 pGCAP1 NM_006805.3  
TGGGTGCCCAGATAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGCCTTGGTTGT
HKR385370 RBd63H02 pGCAP10 NM_006805.3  
GAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGCCTTGGTTGTCTTCCAGTCTCC
HKR388076 RBd70D04 pGCAP10 NM_006805.3  
GGGTGCCCAGATAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGCCTTGGTTGTC
HKR388436 RBd71B12 pGCAP10 NM_006805.3  
GAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGCCTTGGTTGTCTTCCAGTCTCC
HKR408912 RBdS022E16 pGCAP10 NM_006805.3  
GCTCTTTGTGTGGTGCCCAGATAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGC
HKR433262 RBdS083C14 pGCAP10 NM_006805.3  
GTGTGGTGCCCAGATAGGGGAGCGGAGGTGGCGGCGGCGGCGGTAGCGGTGGCCTTGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl