Prev. |  KEGG KO K12827 > 

RIKEN DNA Bank Human Resource - SF3A3

Gene ID NCBI Gene 10946 |  KEGG hsa:10946
Gene Symbol SF3A3
Protein Name splicing factor 3a subunit 3
Synonyms PRP9|PRPF9|SAP61|SF3a60
Ortholog resource in our bank

  SF3A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005351 IRAK013G07 pCMV-SPORT6 BC011523 NM_006802 Full
HGY080524 IRAL001F04 pOTB7 BC002395 NM_006802 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007571 W01A018P11 pENTR-TOPO IRAL001F04 BC002395 NM_006802  
HGE007573 W01A018P13 pENTR-TOPO IRAL001F04 BC002395 NM_006802  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208333 ARiS020N21 pGCAP10 NM_006802.2  
GAGGNNTTGCTTCCGGCCGTGTTGGTGGTCTGAATTGAGAAGCCGCGACTAAGGGAAGAT
HKR235506 ARiS088M18 pGCAP10 NM_006802.2  
GCTGAATTGAGAAGCCGCGACTAAGGGAAGATGGAGACAATACTGGAGCAGCAGCGGCGC
HKR377346 RBd43G02 pGCAP10 NM_006802.2  
GAAGCCGCGACTAAGGGAAGATGGAGACAATACTGGAGCAGCAGCGGCGCTATCATGAGG
HKR385774 RBd64H06 pGCAP10 NM_006802.2  
GAGGNNNTTCTTCCGGCCGTGTTGGTGGTCTGAATTGAGAAGCCGCGACTAAGGGAAGAT
HKR470821 RBdS177A21 pGCAP10 NM_006802.2  
GGACTCAGGCGCGCTGGGCGGCAGGAGTTGCTTCCGGCCGTGTTGGTGGTCTGAATTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl