Prev. | 

RIKEN DNA Bank Human Resource - C11orf58

Gene ID NCBI Gene 10944 |  KEGG hsa:10944
Gene Symbol C11orf58
Protein Name chromosome 11 open reading frame 58
Synonyms IMAGE145052|SMAP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088714 IRAL021N02 pDNR-LIB BC007103 NM_014267 Full
HGY093031 IRAL032J15 pDNR-LIB BC016352 NM_014267 Full
HGY094292 IRAL035M04 pDNR-LIB BC020937 NM_014267 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR045202 ARe13A02 pKA1U5 NM_014267.5  
GGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGATTGTAAGCTGCT
HKR051655 ARe29C07 pKA1U5 NM_014267.5  
GGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGATTGTAAGCTGCT
HKR056475 ARe41D03 pKA1U5 NM_014267.5  
GGACGACTGTGGCAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGG
HKR058877 ARe47D05 pKA1U5 NM_014267.5  
GGAGGGGCTCTGCGCTTCTGTAGTGGCGCTGCTCGGTNCCGATGGCGGATTGTAAGCTGC
HKR160545 ARi01G01 pGCAP10 NM_014267.5  
GAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGAT
HKR168402 ARi21A02 pGCAP10 NM_014267.5  
GAAAGAAGAATCTGCTGAAGAACTCCAAGCTGCTGAGCACCCTGATGAAGTGGAGGATCC
HKR179779 ARi49H11 pGCAP10 NM_014267.5  
GAATTTGCCGGAGGGGCTCTGCGTTCTGAAGTGGCGCTGCTTGGGCCCGNGGCGGATTGT
HKR208098 ARiS020E02 pGCAP10 NM_014267.5  
GGCTTGGGCCCGTGGCGGATTGTAAGCTGCTGGTTTTGCGGCTGGGAAGAGCGGCGAGAG
HKR248969 ARiS122H01 pGCAP10 NM_014267.5  
GGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGATTGTAAGCTGCTGGT
HKR260348 ARiS150O12 pGCAP10 NM_014267.5  
GAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGAT
HKR324547 RBb11G03 pKA1U5 NM_014267.5  
GCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCCTGNCGGATTGTAAGCTGCTGGTTTTG
HKR333345 RBb33G01 pGCAP1 NM_014267.5  
GGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCTTGGCGGATTGTAAGCTGCT
HKR335253 RBb38C05 pGCAP1 NM_014267.5  
GCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGATTGTAAGCT
HKR360835 RBd02B11 pGCAP10 NM_014267.5  
GGCAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCTTGGCGG
HKR406049 RBdS015C01 pGCAP10 NM_014267.5  
GAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCGTGGCGGAT
HKR433379 RBdS083H11 pGCAP10 NM_014267.5  
GAGAGAAGGCCCGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCTTGGCGGAT
HKR462501 RBdS156E05 pGCAP10 NM_014267.5  
GGGAGGGGCTCTGCGTTCTGTAGTGGCGCTGCTTGGGCCCTTGGCGGATTGTAAGCTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl