Prev. |  KEGG KO K08956 > 

RIKEN DNA Bank Human Resource - AFG3L2

Gene ID NCBI Gene 10939 |  KEGG hsa:10939
Gene Symbol AFG3L2
Protein Name AFG3 like matrix AAA peptidase subunit 2
Synonyms SCA28|SPAX5
Ortholog resource in our bank

  AFG3L2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY096954 IRAL042G10 pOTB7 BC024282 NM_006796 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE081213 M01C003A13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081261 M01C003C13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081309 M01C003E13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081357 M01C003G13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081405 M01C003I13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081453 M01C003K13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081501 M01C003M13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE081549 M01C003O13 pDONR221 04-134-2_2-A07 BC065016 NM_006796  
HGE110410 M01C076A10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110458 M01C076C10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110506 M01C076E10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110554 M01C076G10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110602 M01C076I10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110650 M01C076K10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110698 M01C076M10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE110746 M01C076O10 pDONR221 06-2_01-F05 BC065016 NM_006796  
HGE096036 M01C040B12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096084 M01C040D12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096132 M01C040F12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096180 M01C040H12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096228 M01C040J12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096276 M01C040L12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096324 M01C040N12 pDONR221 MGC09-H06 BC065016 NM_006796  
HGE096372 M01C040P12 pDONR221 MGC09-H06 BC065016 NM_006796  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR123257 ARh08C09 pGCAP1 NM_006796.1  
GGACGCCGCGTTGAGAGCTTGGGCTCCTCCGTGAGCCGCCGGCGCGCTTCGCTGCCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl