Prev. |  KEGG KO K08290 > 

RIKEN DNA Bank Human Resource - FASTK

Gene ID NCBI Gene 10922 |  KEGG hsa:10922
Gene Symbol FASTK
Protein Name Fas activated serine/threonine kinase
Synonyms FAST
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Ortholog resource in our bank

  FASTK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032834 IRAK082B10 pCMV-SPORT6 BC039026 NM_033015 Full
HGY080460 IRAL001C12 pOTB7 BC000377 NM_006712 Partial/var
HGY086887 IRAL017D15 pOTB7 BC006386 NM_033015 Partial/var
HGY090970 IRAL027H02 pOTB7 BC011770 NM_006712 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR164810 ARi12A10 pGCAP10 NM_006712.3  
GGAAGATGGCGGACTCGGTGGCTAGCCGATGAGGAGGCCGCGGGGGGAACCCGGCCCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl