Prev. |  KEGG KO K12181 > 

RIKEN DNA Bank Human Resource - COPS8

Gene ID NCBI Gene 10920 |  KEGG hsa:10920
Gene Symbol COPS8
Protein Name COP9 signalosome subunit 8
Synonyms COP9|CSN8|SGN8
Ortholog resource in our bank

  COPS8

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029427 IRAK073J11 pBluescriptR BC036499 NM_198189 Full
HGY082490 IRAL006D18 pOTB7 BC003090 NM_198189 Full
HGY103800 IRAL059I08 pOTB7 BC080617 NM_198189 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE027137 W01A067O01 pENTR-TOPO IRAK073J11 BC036499 NM_198189  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064931 ARe62F11 pKA1U5 NM_006710.4  
GAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGAT
HKR077275 ARe93D03 pKA1U5 NM_006710.4  
GAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGATGCCAGT
HKR336975 RBb42H07 pGCAP1 NM_006710.4  
GGAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGA
HKR367282 RBd18D10 pGCAP10 NM_006710.4  
GGAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGA
HKR371610 RBd29A10 pGCAP10 NM_006710.4  
GGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGATGCCAGTGGCGGTGATGGCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl