Prev. |  KEGG KO K12181 > 

RIKEN DNA Bank Human Resource - COPS8

Gene ID NCBI Gene 10920 |  KEGG hsa:10920
Gene Symbol COPS8
Protein Name COP9 signalosome subunit 8
Synonyms COP9|CSN8|SGN8
Ortholog resources KEGG ortholog (KEGG orthology K12181) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY029427 IRAK073J11 pBluescriptR BC036499 NM_198189 Full
HGY082490 IRAL006D18 pOTB7 BC003090 NM_198189 Full
HGY103800 IRAL059I08 pOTB7 BC080617 NM_198189 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE027137 W01A067O01 pENTR-TOPO IRAK073J11 BC036499 NM_198189  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR064931 ARe62F11 pKA1U5 NM_006710.4  
GAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGAT
HKR077275 ARe93D03 pKA1U5 NM_006710.4  
GAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGATGCCAGT
HKR336975 RBb42H07 pGCAP1 NM_006710.4  
GGAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGA
HKR367282 RBd18D10 pGCAP10 NM_006710.4  
GGAGGGACAGTCTGGGGTTTGGCTGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGA
HKR371610 RBd29A10 pGCAP10 NM_006710.4  
GGTCCGGACGGTGCAGCGGCGAGGCCGGCCGCGAAGATGCCAGTGGCGGTGATGGCGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl