Prev. |  KEGG KO K11420 > 

RIKEN DNA Bank Human Resource - EHMT2

Gene ID NCBI Gene 10919 |  KEGG hsa:10919
Gene Symbol EHMT2
Protein Name euchromatic histone lysine methyltransferase 2
Synonyms BAT8|C6orf30|G9A|GAT8|KMT1C|NG36
Ortholog resource in our bank

  EHMT2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085097 IRAL012M09 pOTB7 BC002686 NM_006709 Partial
HGY090700 IRAL026M12 pOTB7 BC009351 NM_006709 Partial
HGY096058 IRAL040C10 pOTB7 BC018718 NM_006709 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE040278 W01A100L14 pENTR-TOPO flj0003d05 AK056936 NM_025256  
HGE040314 W01A100N02 pENTR-TOPO flj0003d05 AK056936 NM_025256  
HGE040320 W01A100N08 pENTR-TOPO flj0003d05 AK056936 NM_025256 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066127 ARe65F07 pKA1U5 NM_006709.3  
GGCAAGCGGCGATGGCGGCGGCGGCGGGAGCTGCAGCGGCGGCGGCCGCCGAGGGGGAGG
HKR186853 ARi67C05 pGCAP10 NM_006709.3  
GAGCGCAAGCGGCGATGGCGGCGGCGGCGGGAGCTGCAGCGGCGGCGGCCGCCGAGGGGG
HKR331298 RBb28E02 pGCAP1 NM_006709.3  
GCCCCAGCGNCAAGCGGCGAATGGCGGCGGCGGCGGGAGCTCCNTTNGGCGGCGGCCGCC
HKR453066 RBdS132L02 pGCAP10 NM_006709.3  
GGCCCCCAGCGCAAGCGGCGATGGCGGCGGCGGCGGGAGCTGCAGCGGCGGCGGCCGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl