Prev. |  KEGG KO K04402 > 

RIKEN DNA Bank Human Resource - GADD45G

Gene ID NCBI Gene 10912 |  KEGG hsa:10912
Gene Symbol GADD45G
Protein Name growth arrest and DNA damage inducible gamma
Synonyms CR6|DDIT2|GADD45gamma|GRP17
Featured content Apoptosis - human
Ortholog resource in our bank

  GADD45G

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080623 IRAL001J07 pOTB7 BC000465 NM_006705 Full
HGY083658 IRAL009C10 pOTB7 BC019325 NM_006705 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378897 RBd47E01 pGCAP10 NM_006705.2  
GACTCGCTGGTGGTGGGCGCGCCGTGCTGAGCTCTGGCTGTCAGTGTGTTCGCCCGCGTC
HKR408824 RBdS022A24 pGCAP10 NM_006705.2  
GACTCGCTGGTGGTGGGCGCGCCGTGCTGAGCTCTGGCTGTCAGTGTGTTCGCCCGCGTC
HKR432636 RBdS081J20 pGCAP10 NM_006705.2  
GACTCGCTGGTGGTGGGCGCGCCGTGCTGAGCTCTGGCTGTCAGTGTGTTCGCCCGCGTC
HKR433573 RBdS083P13 pGCAP10 NM_006705.2  
TGGACTCGCTGGTGGTGGGCGCGCCGTGCTGAGCTCTGGCTGTCAGTGTGTTCGCCCGCG
HKR441935 RBdS104N23 pGCAP10 NM_006705.2  
GGCACTCGCTGGTGGTGGGCGCGCCGTGCTGAGCTCTGGCTGTCAGTGTGTTCGCCCGCG
HKR442245 RBdS105K05 pGCAP10 NM_006705.2  
GACTCGCTGGTGGTGGGCGCGCCGTGCTGANCTCTGGCTGTCAGTGTGTTCGCCCGCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl