Prev. |  KEGG KO K12795 > 

RIKEN DNA Bank Human Resource - SUGT1

Gene ID NCBI Gene 10910 |  KEGG hsa:10910
Gene Symbol SUGT1
Protein Name SGT1 homolog, MIS12 kinetochore complex assembly cochaperone
Synonyms SGT1
Ortholog resource in our bank

  SUGT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001377 IRAK003H09 pCMV-SPORT6 BC000911 NM_006704

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235322 ARiS088F02 pGCAP10 NM_006704.2  
GCTCCAGAAGTTTCCCCCTTGGGCGGTGGTGGAGGTGGTAACCGTGATAGTAGCAGCTCC
HKR279345 ARiS198G01 pGCAP10 NM_006704.2  
TGAGCGACTACGAGGGATGGCGGCGGCTGCAGCAGGAACTGCAACATCCCAGAGGTTTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl