Prev. | 

RIKEN DNA Bank Human Resource - JTB

Gene ID NCBI Gene 10899 |  KEGG hsa:10899
Gene Symbol JTB
Protein Name jumping translocation breakpoint
Synonyms HJTB|HSPC222|PAR|hJT
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001371 IRAK003H03 pCMV-SPORT6 BC000996 NM_006694 Full
HGY080492 IRAL001D20 pOTB7 BC000499 NM_006694 Full
HGY080837 IRAL002B13 pOTB7 BC001667 NM_006694 Full
HGY081657 IRAL004C09 pOTB7 BC001363 NM_006694 Full
HGY083606 IRAL009A06 pOTB7 BC019277 NM_006694 Full
HGY085446 IRAL013K06 pOTB7 BC004239 NM_006694 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR185731 ARi64F11 pGCAP10 NM_006694.3  
HKR260197 ARiS150I05 pGCAP10 NM_006694.3  
GAAGCCCCNNCGGGCNACNACCGAACGCCCCCGGGAACACCGGGCCCCGAGCTCGGTCCC
HKR331635 RBb29B11 pGCAP1 NM_006694.3  
GGCCCCCGGGAACACCGGGCCCCGAGCTCGGTCCCGCGCCCGAGGAATCCTCCACGGGGC
HKR365655 RBd14C07 pGCAP10 NM_006694.3  
GATAAGCCCCAGCGGGCGACGACCGAACGCCCCCGGGAACACCGGGCCCCGAGCTCGGTC
HKR470911 RBdS177E15 pGCAP10 NM_006694.3  
GATAAGCCCCAGCGGGCGACGACCGAACGCCCCCGGGAACACCGGGCCCCGAGCTCGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl