Prev. |  KEGG KO K07369 > 

RIKEN DNA Bank Human Resource - MALT1

Gene ID NCBI Gene 10892 |  KEGG hsa:10892
Gene Symbol MALT1
Protein Name MALT1 paracaspase
Synonyms IMD12|MLT|MLT1|PCASP1
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Ortholog resource in our bank

  MALT1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092370 IRAL030P10 pOTB7 BC030143 NM_173844 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100435 M01C051B11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100483 M01C051D11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100531 M01C051F11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100579 M01C051H11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100627 M01C051J11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100675 M01C051L11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100723 M01C051N11 pDONR221 MGC15-C06 BC030143 NM_006785  
HGE100771 M01C051P11 pDONR221 MGC15-C06 BC030143 NM_006785  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR397754 RBd94G10 pGCAP10 NM_006785.2  
GCCCTTTGCGCGGCTGGCGCGGCCAGCAGGCCAGGCTCCCCTCGGCAAACCTGTCTAATT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl