Prev. |  KEGG KO K23284 > 

RIKEN DNA Bank Human Resource - C1QL1

Gene ID NCBI Gene 10882 |  KEGG hsa:10882
Gene Symbol C1QL1
Protein Name complement C1q like 1
Synonyms C1QRF|C1QTNF14|CRF|CTRP14
Ortholog resource in our bank

  C1QL1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084928 IRAL012F08 pOTB7 BC008798 NM_006688

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098041 M01C045B17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098089 M01C045D17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098137 M01C045F17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098185 M01C045H17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098233 M01C045J17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098281 M01C045L17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098329 M01C045N17 pDONR221 MGC12-C09 BC008798 NM_006688  
HGE098377 M01C045P17 pDONR221 MGC12-C09 BC008798 NM_006688  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174460 ARi36C12 pGCAP10 NM_006688.3  
GGCAGGCGGGAGGCGGGAGGCGGGAGGCGG
HKR174526 ARi36F06 pGCAP10 NM_006688.3  
GAGTCCGGCTGCGCATCAGGAGGGAGGCGCGAGGCAGGAGCCGGCGGCTGGGCTCCGCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl