Prev. | 

RIKEN DNA Bank Human Resource - HCP5

Gene ID NCBI Gene 10866 |  KEGG hsa:10866
Gene Symbol HCP5
Protein Name HLA complex P5
Synonyms 6S2650E|D6S2650E|P5-1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR057206 ARe43A06 pKA1U5 NM_006674.2 done
AGATTCTCCCCAGACGCCAAGGTTGCGGGTCATGGAGTCCCGAACCCTCCTCCTGCTGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl