Prev. |  KEGG KO K15294 > 

RIKEN DNA Bank Human Resource - CPLX1

Gene ID NCBI Gene 10815 |  KEGG hsa:10815
Gene Symbol CPLX1
Protein Name complexin 1
Synonyms CPX-I|CPX1|EIEE63
Ortholog resource in our bank

  CPLX1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082046 IRAL005B22 pOTB7 BC002471 NM_006651 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR345275 RBb63D03 pGCAP1 NM_006651.4 full cds  
GCCTTCGCCGCCGCCGCAGCTCACCGGGCGCCACATGGACCCAGCCGGCCCGAGCGCGCC
HKR398897 RBd97E01 pGCAP10 NM_006651.3  
GAGCCGCTCCCGCAGCTCCTGGGGTGGCCCGTGGCCGCCCGGGGGCGGAGCTCGCCCCCC
HKR402840 RBdS007B16 pGCAP10 NM_006651.3  
GGCCACATGGACCCAGCCGGCCCGAGCGCGCCCCGCCGCTGACCGCCCGCGCCCCGGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl