Prev. |  KEGG KO K14567 > 

RIKEN DNA Bank Human Resource - UTP14A

Gene ID NCBI Gene 10813 |  KEGG hsa:10813
Gene Symbol UTP14A
Protein Name UTP14A small subunit processome component
Synonyms NYCO16|SDCCAG16|Utp14|dJ537K23.3
Ortholog resource in our bank

  UTP14A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001898 IRAK004M10 pCMV-SPORT6 BC009649 NM_006649
HGY082495 IRAL006D23 pOTB7 BC001149 NM_006649 Full
HGY093938 IRAL034O02 pOTB7 BC014987 NM_006649 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE097235 M01C043B11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097283 M01C043D11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097331 M01C043F11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097379 M01C043H11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097427 M01C043J11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097475 M01C043L11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097523 M01C043N11 pDONR221 MGC11-C06 BC001149 NM_006649  
HGE097571 M01C043P11 pDONR221 MGC11-C06 BC001149 NM_006649  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR329749 RBb24G05 pGCAP1 NM_006649.2  
AATTGCTTTCCTTCGGCTTCCGTTCTTGGTCCATGTGAGAGAAGCTGGCTGCTGAAATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl