Prev. |  KEGG KO K06083 > 

RIKEN DNA Bank Human Resource - WASF3

Gene ID NCBI Gene 10810 |  KEGG hsa:10810
Gene Symbol WASF3
Protein Name WAS protein family member 3
Synonyms Brush-1|SCAR3|WAVE3
Ortholog resources KEGG ortholog (KEGG orthology K06083) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030932 IRAK077F12 pBluescriptR BC050283 NM_006646

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE090827 M01C027B03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE090875 M01C027D03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE090923 M01C027F03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE090971 M01C027H03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE091019 M01C027J03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE091067 M01C027L03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE091115 M01C027N03 pDONR221 MGC03-C02 BC050283 ENST00000361042  
HGE091163 M01C027P03 pDONR221 MGC03-C02 BC050283 ENST00000361042  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374884 RBd37D12 pGCAP10 NM_006646.4  
GGTGGTGCGAGGCGGGTGCGCCGGGCGGCCGCGGCGCGGCGGGACCATGGAGCTCAGAGC
HKR462701 RBdS156M13 pGCAP10 NM_006646.4  
GGNCNTNCGGTGTGGTGCGAGGCGGGTGCGCCGGGCGGCCGCGGCGCGGCGGGACCATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl